Product Details

SNP ID: rs12030797
Assay Type: Functionally tested
NCBI dbSNP Submissions: 1
Location: Chr.1:1334372 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTACCTGCTCATGCGGCAGCCAGGG[C/T]TCAACACCCCCGAGTTCTTCCTGGG
Phenotype: MIM: 611354 MIM: 615467 MIM: 601365 MIM: 605865
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CPSF3L PubMed Links

Gene Details

Gene: CPSF3L
Gene Name: cleavage and polyadenylation specific factor 3-like

There are no transcripts associated with this gene.

Gene: CPTP
Gene Name: ceramide-1-phosphate transfer protein

There are no transcripts associated with this gene.

Gene: DVL1
Gene Name: dishevelled segment polarity protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004421.2	2467	Intron			NP_004412.2
XM_005244731.3	2467	Intron			XP_005244788.1
XM_005244732.3	2467	Intron			XP_005244789.1
XM_005244733.3	2467	Intron			XP_005244790.1

Gene: MIR6808
Gene Name: microRNA 6808

There are no transcripts associated with this gene.

Gene: TAS1R3
Gene Name: taste 1 receptor member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152228.2	2467	Missense Mutation	CTC,TTC	L823F	NP_689414.1
XM_017002435.1	2467	Missense Mutation	CTC,TTC	L865F	XP_016857924.1
XM_017002436.1	2467	Missense Mutation	CTC,TTC	L864F	XP_016857925.1

View Full Product Details