Product Details

SNP ID: rs73528341
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:29808407 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTCTCTTCTTTTTGCCTTTTTGCT[C/T]CATTTTCTCATCCCTTCTTCAAGGC
Phenotype: MIM: 603213 MIM: 600999 MIM: 612033 MIM: 614386
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KIF22 PubMed Links

Gene Details

Gene: KIF22
Gene Name: kinesin family member 22

There are no transcripts associated with this gene.

Gene: MAZ
Gene Name: MYC associated zinc finger protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042539.2		Intron			NP_001036004.1
NM_001276275.1		Intron			NP_001263204.1
NM_001276276.1		Intron			NP_001263205.1
NM_002383.3		Intron			NP_002374.2
XM_006721047.3		Intron			XP_006721110.1
XM_006721048.3		Intron			XP_006721111.1

Gene: PAGR1
Gene Name: PAXIP1 associated glutamate rich protein 1

There are no transcripts associated with this gene.

Gene: PRRT2
Gene Name: proline rich transmembrane protein 2

There are no transcripts associated with this gene.

View Full Product Details