Product Details

SNP ID

rs72923678

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.18:50269647 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGCATATTTAACTCTGTGAGGAAGG[A/G]CACCAGCTTCTTCTGCAGGACACCC

Phenotype

MIM: 614759 MIM: 156535

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

CFAP53 PubMed Links

Gene Details

Gene

CFAP53

Gene Name

cilia and flagella associated protein 53

There are no transcripts associated with this gene.

Gene

MBD1

Gene Name

methyl-CpG binding domain protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204136.1	2180	Silent Mutation	TGC,TGT	C650C	NP_001191065.1
NM_001204137.1	2180	Intron			NP_001191066.1
NM_001204138.1	2180	Intron			NP_001191067.1
NM_001204139.1	2180	Intron			NP_001191068.1
NM_001204140.1	2180	Intron			NP_001191069.1
NM_001204141.1	2180	Intron			NP_001191070.1
NM_001204142.1	2180	UTR 3			NP_001191071.1
NM_001204143.1	2180	UTR 3			NP_001191072.1
NM_001204151.2	2180	UTR 3			NP_001191080.1
NM_001323942.1	2180	Silent Mutation	TGC,TGT	C675C	NP_001310871.1
NM_001323947.1	2180	Silent Mutation	TGC,TGT	C660C	NP_001310876.1
NM_001323949.1	2180	UTR 3			NP_001310878.1
NM_001323950.1	2180	UTR 3			NP_001310879.1
NM_001323951.1	2180	Intron			NP_001310880.1
NM_001323952.1	2180	UTR 3			NP_001310881.1
NM_001323953.1	2180	Intron			NP_001310882.1
NM_001323954.1	2180	Silent Mutation	TGC,TGT	C571C	NP_001310883.1
NM_002384.2	2180	UTR 3			NP_002375.1
NM_015844.2	2180	UTR 3			NP_056669.2
NM_015845.3	2180	Silent Mutation	TGC,TGT	C581C	NP_056670.2
NM_015846.3	2180	UTR 3			NP_056671.2
NM_015847.3	2180	UTR 3			NP_056723.2
XM_005258271.2	2180	UTR 3			XP_005258328.1
XM_006722456.2	2180	UTR 3			XP_006722519.1
XM_011525991.1	2180	Silent Mutation	TGC,TGT	C629C	XP_011524293.1
XM_011525993.2	2180	UTR 3			XP_011524295.1
XM_011525994.2	2180	UTR 3			XP_011524296.1
XM_011525998.2	2180	Intron			XP_011524300.1
XM_011525999.1	2180	Silent Mutation	TGC,TGT	C604C	XP_011524301.1
XM_011526001.1	2180	Silent Mutation	TGC,TGT	C594C	XP_011524303.1
XM_011526002.1	2180	UTR 3			XP_011524304.1
XM_011526003.2	2180	UTR 3			XP_011524305.1
XM_011526006.1	2180	UTR 3			XP_011524308.1
XM_011526007.1	2180	UTR 3			XP_011524309.1
XM_017025751.1	2180	UTR 3			XP_016881240.1
XM_017025752.1	2180	Silent Mutation	TGC,TGT	C635C	XP_016881241.1
XM_017025753.1	2180	UTR 3			XP_016881242.1
XM_017025754.1	2180	Intron			XP_016881243.1
XM_017025755.1	2180	Intron			XP_016881244.1
XM_017025756.1	2180	UTR 3			XP_016881245.1
XM_017025757.1	2180	UTR 3			XP_016881246.1
XM_017025758.1	2180	UTR 3			XP_016881247.1
XM_017025759.1	2180	UTR 3			XP_016881248.1
XM_017025760.1	2180	UTR 3			XP_016881249.1
XM_017025761.1	2180	Intron			XP_016881250.1
XM_017025762.1	2180	UTR 3			XP_016881251.1
XM_017025763.1	2180	UTR 3			XP_016881252.1
XM_017025764.1	2180	UTR 3			XP_016881253.1
XM_017025765.1	2180	UTR 3			XP_016881254.1
XM_017025766.1	2180	UTR 3			XP_016881255.1
XM_017025767.1	2180	UTR 3			XP_016881256.1
XM_017025768.1	2180	Intron			XP_016881257.1
XM_017025769.1	2180	UTR 3			XP_016881258.1
XM_017025770.1	2180	UTR 3			XP_016881259.1
XM_017025771.1	2180	UTR 3			XP_016881260.1
XM_017025772.1	2180	Intron			XP_016881261.1
XM_017025773.1	2180	UTR 3			XP_016881262.1
XM_017025774.1	2180	UTR 3			XP_016881263.1
XM_017025775.1	2180	Intron			XP_016881264.1
XM_017025776.1	2180	UTR 3			XP_016881265.1
XM_017025777.1	2180	Intron			XP_016881266.1

View Full Product Details