Product Details

SNP ID: rs73511851
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:17303957 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAACCATTATTTGCTAACCTCCCC[C/T]CTACGCCCCCCCCTTTTCTTTTGGT
Phenotype: MIM: 611840
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ABHD8 PubMed Links

Gene Details

Gene: ABHD8
Gene Name: abhydrolase domain containing 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024527.4		Intron			NP_078803.4

Gene: DDA1
Gene Name: DET1 and DDB1 associated 1

There are no transcripts associated with this gene.

Gene: MRPL34
Gene Name: mitochondrial ribosomal protein L34

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_023937.3		Intron			NP_076426.1
XM_011528189.2		Intron			XP_011526491.1

View Full Product Details