Product Details

SNP ID: rs560618
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:62707781 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGCCCTCCCCAGGGGCCTCCTTTC[C/G]TATAGTCACTGCTTCTGCATCAGAT
Phenotype: MIM: 606158 MIM: 608941
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: BSCL2 PubMed Links

Gene Details

Gene: BSCL2
Gene Name: BSCL2, seipin lipid droplet biogenesis associated

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001122955.3	175	Intron			NP_001116427.1
NM_001130702.2	175	Intron			NP_001124174.2
NM_032667.6	175	Intron			NP_116056.3

Gene: GNG3
Gene Name: G protein subunit gamma 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012202.4	175	UTR 5			NP_036334.1
XM_006718500.2	175	UTR 5			XP_006718563.1

Gene: HNRNPUL2
Gene Name: heterogeneous nuclear ribonucleoprotein U like 2

There are no transcripts associated with this gene.

Gene: HNRNPUL2-BSCL2
Gene Name: HNRNPUL2-BSCL2 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details