Product Details

SNP ID: rs12805811
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:67405769 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCAGGTGCTCCAGCCCACTTTCCC[C/T]AGCCCAGCTCTACAGTCTTGCATCT
Phenotype: MIM: 613368 MIM: 176875 MIM: 603761 MIM: 610831
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CARNS1 PubMed Links

Gene Details

Gene: CARNS1
Gene Name: carnosine synthase 1

There are no transcripts associated with this gene.

Gene: PPP1CA
Gene Name: protein phosphatase 1 catalytic subunit alpha

There are no transcripts associated with this gene.

Gene: RAD9A
Gene Name: RAD9 checkpoint clamp component A

There are no transcripts associated with this gene.

Gene: TBC1D10C
Gene Name: TBC1 domain family member 10C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256508.1		Intron			NP_001243437.1
NM_198517.3		Intron			NP_940919.1
XM_006718538.3		Intron			XP_006718601.1
XM_006718539.3		Intron			XP_006718602.1
XM_006718540.3		Intron			XP_006718603.1
XM_006718541.3		Intron			XP_006718604.1
XM_006718542.3		Intron			XP_006718605.1
XM_006718543.2		Intron			XP_006718606.1
XM_006718544.3		Intron			XP_006718607.1
XM_011545001.2		Intron			XP_011543303.1
XM_011545002.2		Intron			XP_011543304.1

View Full Product Details