Product Details
- SNP ID
-
rs11622265
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.14:100898684 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CACGGGGCTACCTGTTTCTCTCAGC[A/G]GGCTCCCTACTTCTTAGGCTTTGCG
- Phenotype
-
MIM: 613648
MIM: 613649
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
MEG8
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs75866233] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MEG8
- Gene Name
- maternally expressed 8 (non-protein coding)
There are no transcripts associated with this gene.
- Gene
- SNORD112
- Gene Name
- small nucleolar RNA, C/D box 112
There are no transcripts associated with this gene.
View Full Product Details