Product Details

SNP ID: rs2295362
Assay Type: Validated
NCBI dbSNP Submissions: 40
Location: Chr.1:1923880 on Build GRCh38
Set Membership: JSNP Validated
Context Sequence [VIC/FAM]: GTGTCTTCCCGGGGTCCATGACGCC[T/C]TTGACGGGGGCCACGCTGAACACGC
Phenotype: MIM: 610171
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: CALML6 PubMed Links

Gene Details

Gene: CALML6
Gene Name: calmodulin like 6

There are no transcripts associated with this gene.

Gene: CFAP74
Gene Name: cilia and flagella associated protein 74

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304360.1	3869	Silent Mutation	AAA,AAG	K1428K	NP_001291289.1
XM_011542333.2	3869	Silent Mutation	AAA,AAG	K1451K	XP_011540635.2
XM_011542335.1	3869	Silent Mutation	AAA,AAG	K1259K	XP_011540637.1
XM_011542336.2	3869	Silent Mutation	AAA,AAG	K1259K	XP_011540638.1
XM_017002641.1	3869	Silent Mutation	AAA,AAG	K1470K	XP_016858130.1
XM_017002642.1	3869	Silent Mutation	AAA,AAG	K1470K	XP_016858131.1
XM_017002643.1	3869	Silent Mutation	AAA,AAG	K1470K	XP_016858132.1
XM_017002644.1	3869	Silent Mutation	AAA,AAG	K614K	XP_016858133.1

Gene: TMEM52
Gene Name: transmembrane protein 52

There are no transcripts associated with this gene.

View Full Product Details