Product Details

SNP ID: rs10444856
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:75940081 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAATCCTATATGTTCACAAATGATA[C/T]GATCTTTAGACAACCCGAAAGATTC
Phenotype: MIM: 609096 MIM: 610894
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FBXO22 PubMed Links

Gene Details

Gene: FBXO22
Gene Name: F-box protein 22

There are no transcripts associated with this gene.

Gene: FBXO22-AS1
Gene Name: FBXO22 antisense RNA 1

There are no transcripts associated with this gene.

Gene: NRG4
Gene Name: neuregulin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_138573.3		Intron			NP_612640.1
XM_017021937.1		Intron			XP_016877426.1
XM_017021938.1		Intron			XP_016877427.1
XM_017021939.1		Intron			XP_016877428.1
XM_017021940.1		Intron			XP_016877429.1
XM_017021941.1		Intron			XP_016877430.1
XM_017021942.1		Intron			XP_016877431.1
XM_017021943.1		Intron			XP_016877432.1
XM_017021944.1		Intron			XP_016877433.1
XM_017021945.1		Intron			XP_016877434.1
XM_017021946.1		Intron			XP_016877435.1
XM_017021947.1		Intron			XP_016877436.1
XM_017021948.1		Intron			XP_016877437.1

View Full Product Details