Product Details

SNP ID: rs354020
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49335634 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CGTGAGTTGCCTCATGGCTACCCAG[A/C]CGGGGCCCAGCCCCTGCCGCTAACC
Phenotype: MIM: 151523 MIM: 607972 MIM: 601729
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CD37 PubMed Links

Gene Details

Gene: CD37
Gene Name: CD37 molecule

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040031.1		Intron			NP_001035120.1
NM_001774.2		Intron			NP_001765.1
XM_005259435.3		Intron			XP_005259492.1
XM_005259436.3		Intron			XP_005259493.1
XM_011527542.2		Intron			XP_011525844.1
XM_011527543.2		Intron			XP_011525845.1
XM_011527544.2		Intron			XP_011525846.1
XM_017027513.1		Intron			XP_016883002.1

Gene: SLC6A16
Gene Name: solute carrier family 6 member 16

There are no transcripts associated with this gene.

Gene: TEAD2
Gene Name: TEA domain transcription factor 2

There are no transcripts associated with this gene.

View Full Product Details