Product Details

SNP ID: rs35791962
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49680192 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCATTTTCCTTCCCCTCCCCTCCC[C/T]AGCTGTGGGCTGAGCTAGAGACGGG
Phenotype: MIM: 610837 MIM: 602950
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ADM5 PubMed Links

Gene Details

Gene: ADM5
Gene Name: adrenomedullin 5 (putative)

There are no transcripts associated with this gene.

Gene: BCL2L12
Gene Name: BCL2 like 12

There are no transcripts associated with this gene.

Gene: MIR5088
Gene Name: microRNA 5088

There are no transcripts associated with this gene.

Gene: PRMT1
Gene Name: protein arginine methyltransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001207042.2	161	Intron			NP_001193971.1
NM_001536.5	161	Intron			NP_001527.3
NM_198318.4	161	Intron			NP_938074.2
XM_005258842.1	161	UTR 5			XP_005258899.1
XM_017026734.1	161	UTR 5			XP_016882223.1
XM_017026735.1	161	UTR 5			XP_016882224.1
XM_017026736.1	161	UTR 5			XP_016882225.1

View Full Product Details