Product Details
- SNP ID
-
rs12482797
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.21:45413172 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CATCCCCACCCTTAGGGCAGAGCCC[C/T]GTAGGAGGGACTGGTTTGCAACGTG
- Phenotype
-
MIM: 120328
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
COL18A1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs76701795] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- COL18A1
- Gene Name
- collagen type XVIII alpha 1 chain
- Gene
- COL18A1-AS1
- Gene Name
- COL18A1 antisense RNA 1
There are no transcripts associated with this gene.
- Gene
- COL18A1-AS2
- Gene Name
- COL18A1 antisense RNA 2
There are no transcripts associated with this gene.
View Full Product Details