Product Details

SNP ID: rs581808
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:42605623 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTATATTCAAAATTAAACTAAACTT[C/T]AGACTCACATTCAAAATAGCTCATA
Phenotype: MIM: 161565 MIM: 604028
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC101928323 PubMed Links

Gene Details

Gene: LOC101928323
Gene Name: uncharacterized LOC101928323

There are no transcripts associated with this gene.

Gene: NKTR
Gene Name: natural killer cell triggering receptor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005385.3		Intron			NP_005376.2
XM_005265173.1		Intron			XP_005265230.1
XM_006713171.1		Intron			XP_006713234.1
XM_006713173.2		Intron			XP_006713236.1
XM_011533747.2		Intron			XP_011532049.1
XM_011533750.2		Intron			XP_011532052.1
XM_017006474.1		Intron			XP_016861963.1
XM_017006475.1		Intron			XP_016861964.1
XM_017006476.1		Intron			XP_016861965.1
XM_017006477.1		Intron			XP_016861966.1
XM_017006478.1		Intron			XP_016861967.1
XM_017006479.1		Intron			XP_016861968.1
XM_017006480.1		Intron			XP_016861969.1

Gene: SEC22C
Gene Name: SEC22 homolog C, vesicle trafficking protein

There are no transcripts associated with this gene.

View Full Product Details