Product Details

SNP ID: rs1136666
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.12:6534825 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CTCCGCGCAGCCGAGCCACATCGCT[C/G]AGACACCATGGGGAAGGTGAAGGTC
Phenotype: MIM: 138400 MIM: 610495 MIM: 615638
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: GAPDH PubMed Links

Gene Details

Gene: GAPDH
Gene Name: glyceraldehyde-3-phosphate dehydrogenase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256799.2		Intron			NP_001243728.1
NM_001289745.1		Intron			NP_001276674.1
NM_001289746.1		Intron			NP_001276675.1
NM_002046.5		Intron			NP_002037.2

Gene: IFFO1
Gene Name: intermediate filament family orphan 1

There are no transcripts associated with this gene.

Gene: NCAPD2
Gene Name: non-SMC condensin I complex subunit D2

There are no transcripts associated with this gene.

View Full Product Details