Product Details

SNP ID: rs17885346
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.15:79913495 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: CTTCATAAACGTATCCAGTGAGCCA[A/G]GATGTAGCTTGACATGGGTTTAGGC
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ST20 PubMed Links

Gene Details

Gene: ST20
Gene Name: suppressor of tumorigenicity 20

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001100879.1		Intron			NP_001094349.1
NM_001100880.2		Intron			NP_001094350.1
NM_001199757.1		Intron			NP_001186686.1

Gene: ST20-AS1
Gene Name: ST20 antisense RNA 1

There are no transcripts associated with this gene.

Gene: ST20-MTHFS
Gene Name: ST20-MTHFS readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199760.1		Intron			NP_001186689.1

View Full Product Details