Product Details

SNP ID: rs4724257
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:43927631 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATAACTAATTTTTAACATTAACTTT[C/T]CACAAGTACATGACTAGTAACTTAT
Phenotype: MIM: 610337
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC107986791 PubMed Links

Gene Details

Gene: LOC107986791
Gene Name: uncharacterized LOC107986791

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017012920.1		Intron			XP_016868409.1
XM_017012921.1		Intron			XP_016868410.1
XM_017012922.1		Intron			XP_016868411.1

Gene: UBE2D4
Gene Name: ubiquitin conjugating enzyme E2 D4 (putative)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015983.3		Intron			NP_057067.1
XM_006715734.3		Intron			XP_006715797.1
XM_011515420.2		Intron			XP_011513722.1
XM_011515422.2		Intron			XP_011513724.1
XM_011515423.2		Intron			XP_011513725.1
XM_017012292.1		Intron			XP_016867781.1
XM_017012293.1		Intron			XP_016867782.1
XM_017012294.1		Intron			XP_016867783.1
XM_017012295.1		Intron			XP_016867784.1

Gene: URGCP
Gene Name: upregulator of cell proliferation

There are no transcripts associated with this gene.

View Full Product Details