Product Details

SNP ID: rs2041386
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6453372 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGACAGCCCAGGTCCCGATTACAGC[C/T]ACACATACTGCCTCCCGTTGGCCCT
Phenotype: MIM: 186711 MIM: 607081 MIM: 185880
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CD27 PubMed Links

Gene Details

Gene: CD27
Gene Name: CD27 molecule

There are no transcripts associated with this gene.

Gene: CD27-AS1
Gene Name: CD27 antisense RNA 1

There are no transcripts associated with this gene.

Gene: TAPBPL
Gene Name: TAP binding protein like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018009.4		Intron			NP_060479.3
XM_005253700.3		Intron			XP_005253757.1
XM_017019545.1		Intron			XP_016875034.1
XM_017019546.1		Intron			XP_016875035.1

Gene: VAMP1
Gene Name: vesicle associated membrane protein 1

There are no transcripts associated with this gene.

View Full Product Details