Product Details
- SNP ID
-
rs575955
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:60927903 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCTAGGCTGGTCCTGCTGCAGCTGC[A/G]TCAGCCAGGTGGTGGGCCCGCGGCA
- Phenotype
-
MIM: 610408
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
SLC15A3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs79330054] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- SLC15A3
- Gene Name
- solute carrier family 15 member 3
There are no transcripts associated with this gene.
- Gene
- TMEM109
- Gene Name
- transmembrane protein 109
There are no transcripts associated with this gene.
- Gene
- TMEM132A
- Gene Name
- transmembrane protein 132A
View Full Product Details