Product Details

SNP ID: rs11577746
Assay Type: Functionally tested
NCBI dbSNP Submissions: 33
Location: Chr.1:15735091 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATCTGCAGCCCACCCCGGGGCAGG[A/G]CGCTCCTGCCTCCACAGCCCCGGGG
Phenotype: MIM: 609613 MIM: 610817
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: PLEKHM2 PubMed Links

Gene Details

Gene: PLEKHM2
Gene Name: pleckstrin homology and RUN domain containing M2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015164.2	4	Intron			NP_055979.2
XM_005245790.3	4	Intron			XP_005245847.1
XM_005245791.4	4	Intron			XP_005245848.1
XM_017000757.1	4	Intron			XP_016856246.1
XM_017000758.1	4	Intron			XP_016856247.1

Gene: SLC25A34
Gene Name: solute carrier family 25 member 34

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_207348.2	4	Intron			NP_997231.1
XM_011541292.2	4	UTR 5			XP_011539594.1
XM_011541293.1	4	UTR 5			XP_011539595.1
XM_017001083.1	4	UTR 5			XP_016856572.1

Gene: TMEM82
Gene Name: transmembrane protein 82

There are no transcripts associated with this gene.

View Full Product Details