Product Details

SNP ID: rs11076716
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:88814557 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATGAAAATTGAGAAAAAGAACATG[C/G]AGTTATTCAAGCTCTTCTGGACCCA
Phenotype: MIM: 102600 MIM: 605525 MIM: 612222
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: APRT PubMed Links

Gene Details

Gene: APRT
Gene Name: adenine phosphoribosyltransferase

There are no transcripts associated with this gene.

Gene: CDT1
Gene Name: chromatin licensing and DNA replication factor 1

There are no transcripts associated with this gene.

Gene: GALNS
Gene Name: galactosamine (N-acetyl)-6-sulfatase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000512.4	4478	Intron			NP_000503.1
NM_001323543.1	4478	Intron			NP_001310472.1
NM_001323544.1	4478	Intron			NP_001310473.1
XM_005256301.3	4478	UTR 3			XP_005256358.1
XM_011522982.2	4478	UTR 3			XP_011521284.1
XM_017023111.1	4478	Intron			XP_016878600.1
XM_017023112.1	4478	UTR 3			XP_016878601.1
XM_017023113.1	4478	UTR 3			XP_016878602.1

Gene: LOC107987238
Gene Name: proline-rich proteoglycan 2-like

There are no transcripts associated with this gene.

View Full Product Details