Product Details
- SNP ID
-
rs663767
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:65021605 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- GGCGGGGCTTCCTGGATGGGATGAC[A/C]TGGAGCAGGGCCTTGAGGAAGGCGT
- Phenotype
-
MIM: 601175
MIM: 605964
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ARL2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs114453624] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ARL2
- Gene Name
- ADP ribosylation factor like GTPase 2
- Gene
- ARL2-SNX15
- Gene Name
- ARL2-SNX15 readthrough (NMD candidate)
There are no transcripts associated with this gene.
- Gene
- MIR6879
- Gene Name
- microRNA 6879
There are no transcripts associated with this gene.
- Gene
- SNX15
- Gene Name
- sorting nexin 15
There are no transcripts associated with this gene.
View Full Product Details