Product Details
- SNP ID
-
rs2515392
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.2:113059604 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTGGGAAATTGTGACCAGCACCTCA[C/T]TGCTCTTAGAGTTTTCCCAGCCTTT
- Phenotype
-
MIM: 615296
MIM: 605508
MIM: 605507
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
IL1F10
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs113368862] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- IL1F10
- Gene Name
- interleukin 1 family member 10 (theta)
There are no transcripts associated with this gene.
- Gene
- IL36B
- Gene Name
- interleukin 36, beta
There are no transcripts associated with this gene.
- Gene
- IL36RN
- Gene Name
- interleukin 36 receptor antagonist
View Full Product Details