Product Details
- SNP ID
-
rs12971357
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:41024682 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GACTGAGGCACACATCCAGGTTTCA[A/G]TGAAGGTGGATTGGAGCGCACAGCT
- Phenotype
-
MIM: 123930
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CYP2A7P1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs115773266] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CYP2A7P1
- Gene Name
- cytochrome P450 family 2 subfamily A member 7 pseudogene 1
There are no transcripts associated with this gene.
- Gene
- CYP2B6
- Gene Name
- cytochrome P450 family 2 subfamily B member 6
There are no transcripts associated with this gene.
View Full Product Details