Product Details

SNP ID: rs1043768
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:153974556 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCTGCTCATTAATGATCTGAAAGAA[A/G]AAGATGGGGAAAAGGGGATTCCACC
Phenotype: MIM: 607138 MIM: 604671 MIM: 602672 MIM: 604740
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CREB3L4 PubMed Links

Gene Details

Gene: CREB3L4
Gene Name: cAMP responsive element binding protein 3 like 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001255978.1	1287	Intron			NP_001242907.1
NM_001255979.1	1287	Intron			NP_001242908.1
NM_001255980.1	1287	Intron			NP_001242909.1
NM_001255981.1	1287	Intron			NP_001242910.1
NM_130898.3	1287	Intron			NP_570968.1
XM_006711172.2	1287	Intron			XP_006711235.1
XM_017000372.1	1287	Intron			XP_016855861.1

Gene: JTB
Gene Name: jumping translocation breakpoint

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006694.3	1287	UTR 3			NP_006685.1

Gene: RAB13
Gene Name: RAB13, member RAS oncogene family

There are no transcripts associated with this gene.

Gene: SLC39A1
Gene Name: solute carrier family 39 member 1

There are no transcripts associated with this gene.

View Full Product Details