Product Details

SNP ID: rs775242
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57605763 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATGAGAACTTTGTTATTGCAGGGGC[A/T]GCTGCCACTTTGTTCACATCCTTAA
Phenotype: MIM: 610215 MIM: 613142
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: ARHGEF25 PubMed Links

Gene Details

Gene: ARHGEF25
Gene Name: Rho guanine nucleotide exchange factor 25

There are no transcripts associated with this gene.

Gene: DTX3
Gene Name: deltex E3 ubiquitin ligase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286245.1		Intron			NP_001273174.1
NM_001286246.1		Intron			NP_001273175.1
NM_178502.3		Intron			NP_848597.1
XM_005268697.1		Intron			XP_005268754.1
XM_005268698.1		Intron			XP_005268755.1
XM_005268700.1		Intron			XP_005268757.1
XM_005268703.1		Intron			XP_005268760.1
XM_011538022.2		Intron			XP_011536324.1

Gene: PIP4K2C
Gene Name: phosphatidylinositol-5-phosphate 4-kinase type 2 gamma

There are no transcripts associated with this gene.

View Full Product Details