Product Details

SNP ID: rs2691257
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:51013391 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTATATTCAGCTAGCTTATGTTACT[G/T]CTTCAAAGTTCAGGATAAGCTGAGA
Phenotype: MIM: 602673 MIM: 604434 MIM: 605504
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: KLK10 PubMed Links

Gene Details

Gene: KLK10
Gene Name: kallikrein related peptidase 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077500.1	2360	UTR 3			NP_001070968.1
NM_002776.4	2360	UTR 3			NP_002767.2
NM_145888.2	2360	UTR 3			NP_665895.1
XM_005259061.3	2360	Intron			XP_005259118.1
XM_005259062.3	2360	Intron			XP_005259119.1
XM_006723287.3	2360	Intron			XP_006723350.1
XM_006723289.3	2360	Intron			XP_006723352.1
XM_017026993.1	2360	Intron			XP_016882482.1

Gene: KLK11
Gene Name: kallikrein related peptidase 11

There are no transcripts associated with this gene.

Gene: KLK9
Gene Name: kallikrein related peptidase 9

There are no transcripts associated with this gene.

View Full Product Details