Product Details

SNP ID: rs17575205
Assay Type: Validated
NCBI dbSNP Submissions: 35
Location: Chr.1:109494376 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: GGAGCCCCGGGAGACTTGGAGGAGG[C/G]ACCCCAGCAGTAAAGGGGAGACAGA
Phenotype: MIM: 615689
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: AMIGO1 PubMed Links

Gene Details

Gene: AMIGO1
Gene Name: adhesion molecule with Ig like domain 1

There are no transcripts associated with this gene.

Gene: ATXN7L2
Gene Name: ataxin 7 like 2

There are no transcripts associated with this gene.

Gene: CYB561D1
Gene Name: cytochrome b561 family member D1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134400.1		Intron			NP_001127872.1
NM_001134402.1		Intron			NP_001127874.1
NM_001134403.1		Intron			NP_001127875.1
NM_001134404.1		Intron			NP_001127876.1
NM_182580.2		Intron			NP_872386.1
XM_005270775.2		Intron			XP_005270832.1
XM_005270776.3		Intron			XP_005270833.1
XM_005270777.2		Intron			XP_005270834.1
XM_011541286.2		Intron			XP_011539588.1
XM_011541287.2		Intron			XP_011539589.2
XM_017001078.1		Intron			XP_016856567.1
XM_017001079.1		Intron			XP_016856568.1

View Full Product Details