Product Details

SNP ID: rs967591
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.19:45406676 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: TGCGAGCAGCCCGGGCTACAGGGTT[A/G]CCTGAGGTGTGGGTCCCAGGATGGA
Phenotype: MIM: 107325 MIM: 126380 MIM: 607463
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CD3EAP PubMed Links
Additional Information: For this assay, SNP(s) [rs35780931,rs8113779] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Protein ID
NM_001297590.1	548	UTR 5	NP_001284519.1
NM_012099.1	548	UTR 5	NP_036231.1
XM_017026180.1	548	UTR 5	XP_016881669.1
XM_017026181.1	548	UTR 5	XP_016881670.1

Transcript Accession	SNP Location	SNP Type	Protein ID
NM_001166049.1	548	Intron	NP_001159521.1
NM_001983.3	548	Intron	NP_001974.1
NM_202001.2	548	Intron	NP_973730.1
XM_005258634.1	548	Intron	XP_005258691.1
XM_005258635.2	548	Intron	XP_005258692.1
XM_005258636.4	548	Intron	XP_005258693.1
XM_005258637.1	548	Intron	XP_005258694.1
XM_011526610.2	548	Intron	XP_011524912.1
XM_017026459.1	548	Intron	XP_016881948.1
XM_017026460.1	548	Intron	XP_016881949.1
XM_017026461.1	548	Intron	XP_016881950.1
XM_017026462.1	548	Intron	XP_016881951.1
XM_017026463.1	548	Intron	XP_016881952.1
XM_017026464.1	548	Intron	XP_016881953.1
XM_017026465.1	548	Intron	XP_016881954.1
XM_017026466.1	548	Intron	XP_016881955.1

Transcript Accession	SNP Location	SNP Type	Protein ID
NM_001142502.1	548	Intron	NP_001135974.1
NM_006663.3	548	Intron	NP_006654.2
XM_017026177.1	548	Intron	XP_016881666.1
XM_017026178.1	548	Intron	XP_016881667.1
XM_017026179.1	548	Intron	XP_016881668.1