Product Details

SNP ID: rs1275536
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27217917 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGTCGGCTACCCCGAGGCCCTCAC[C/T]GATCCCTCCTACAAGGCACAGATCT
Phenotype: MIM: 114010 MIM: 604024
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ATRAID PubMed Links

Gene Details

Gene: ATRAID
Gene Name: all-trans retinoic acid induced differentiation factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001170795.1	285	Intron			NP_001164266.1
NM_016085.4	285	Intron			NP_057169.2
NM_080592.3	285	Intron			NP_542159.3

Gene: CAD
Gene Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001306079.1	285	Silent Mutation	ACC,ACT	T41T	NP_001293008.1
NM_004341.4	285	Silent Mutation	ACC,ACT	T41T	NP_004332.2
XM_005264555.3	285	Silent Mutation	ACC,ACT	T41T	XP_005264612.1
XM_006712101.2	285	Silent Mutation	ACC,ACT	T41T	XP_006712164.1

Gene: SLC5A6
Gene Name: solute carrier family 5 member 6

There are no transcripts associated with this gene.

View Full Product Details