Product Details

SNP ID: rs1802885
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:10832810 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGTCGGTGCAGCCACTGAGCCGTCC[C/T]TTCTACAAGCCAGAGGTGTTCCCTG
Phenotype: MIM: 602378 MIM: 605395
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C19orf38 PubMed Links

Gene Details

Gene: C19orf38
Gene Name: chromosome 19 open reading frame 38

There are no transcripts associated with this gene.

Gene: DNM2
Gene Name: dynamin 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005360.2	985	Intron			NP_001005360.1
NM_001005361.2	985	Intron			NP_001005361.1
NM_001005362.2	985	Intron			NP_001005362.1
NM_001190716.1	985	Intron			NP_001177645.1
NM_004945.3	985	Intron			NP_004936.2

Gene: MIR6793
Gene Name: microRNA 6793

There are no transcripts associated with this gene.

Gene: TMED1
Gene Name: transmembrane p24 trafficking protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006858.3	985	UTR 3			NP_006849.1
XM_006722631.3	985	UTR 3			XP_006722694.1

View Full Product Details