Product Details

SNP ID: rs1057373
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:32845502 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGTAACTCATCCTGGAGGCAGCTGC[A/C]TACTCTGCAGCTGTGGTTCTCCACC
Phenotype: MIM: 177046 MIM: 177045 MIM: 170260 MIM: 170261
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: PSMB8 PubMed Links

Gene Details

Gene: PSMB8
Gene Name: proteasome subunit beta 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004159.4	2659	Intron			NP_004150.1
NM_148919.3	2659	Intron			NP_683720.2

Gene: PSMB8-AS1
Gene Name: PSMB8 antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: PSMB9
Gene Name: proteasome subunit beta 9

There are no transcripts associated with this gene.

Gene: TAP1
Gene Name: transporter 1, ATP binding cassette subfamily B member

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000593.5	2659	UTR 3			NP_000584.2
NM_001292022.1	2659	UTR 3			NP_001278951.1

Gene: TAP2
Gene Name: transporter 2, ATP binding cassette subfamily B member

There are no transcripts associated with this gene.

View Full Product Details