Product Details

SNP ID: rs1063473
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:132874481 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGGGAAAGAAAGGACAGCAGTCAC[C/T]TCCGACAATGCTCCGTTCTATGGAA
Phenotype: MIM: 604417 MIM: 601918 MIM: 611373 MIM: 612080
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AFF4 PubMed Links

Gene Details

Gene: AFF4
Gene Name: AF4/FMR2 family member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014423.3	298	Intron			NP_055238.1
XM_005271963.4	298	Intron			XP_005272020.1
XM_005271964.4	298	Intron			XP_005272021.1
XM_006714587.3	298	Intron			XP_006714650.1

Gene: GDF9
Gene Name: growth differentiation factor 9

There are no transcripts associated with this gene.

Gene: LEAP2
Gene Name: liver enriched antimicrobial peptide 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_052971.2	298	UTR 3			NP_443203.1

Gene: UQCRQ
Gene Name: ubiquinol-cytochrome c reductase complex III subunit VII

There are no transcripts associated with this gene.

View Full Product Details