Product Details

SNP ID: rs1546959
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:89647499 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTTTGCAGAATGTTCCAAACTACTC[A/G]GAAAAAAAAGTAGGGAGCTAGAAAA
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC101929057 PubMed Links

Gene Details

Gene: LOC101929057
Gene Name: uncharacterized LOC101929057

There are no transcripts associated with this gene.

Gene: LYRM2
Gene Name: LYR motif containing 2

There are no transcripts associated with this gene.

Gene: MDN1
Gene Name: midasin AAA ATPase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014611.2		Intron			NP_055426.1
XM_005248700.3		Intron			XP_005248757.1
XM_006715405.3		Intron			XP_006715468.1
XM_011535635.2		Intron			XP_011533937.1
XM_011535636.2		Intron			XP_011533938.1

View Full Product Details