Product Details

SNP ID: rs7682
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.6:89643143 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GGAGCTGCTGAGTTCTGGACACAGC[A/G]TTTCTTTCCCAGAATGAGACTGGCT
Phenotype: MIM: 610583
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ANKRD6 PubMed Links

Gene Details

Gene: ANKRD6
Gene Name: ankyrin repeat domain 6

There are no transcripts associated with this gene.

Gene: LOC101929057
Gene Name: uncharacterized LOC101929057

There are no transcripts associated with this gene.

Gene: LYRM2
Gene Name: LYR motif containing 2

There are no transcripts associated with this gene.

Gene: MDN1
Gene Name: midasin AAA ATPase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014611.2	17645	UTR 3			NP_055426.1
XM_005248700.3	17645	UTR 3			XP_005248757.1
XM_006715405.3	17645	UTR 3			XP_006715468.1
XM_011535635.2	17645	UTR 3			XP_011533937.1
XM_011535636.2	17645	Intron			XP_011533938.1

View Full Product Details