Product Details

SNP ID

rs11636728

Assay Type

Validated

NCBI dbSNP Submissions

NA

Location

Chr.15:99581527 on Build GRCh38

Set Membership

HapMap Validated

Context Sequence [VIC/FAM]

AAACTCTTTCTTTTTATTGACCTCC[C/T]GTGTTTTTCTTTCAACTGGTGAATA

Phenotype

MIM: 600660

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

MEF2A PubMed Links

Additional Information

For this assay, SNP(s) [rs117912280] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

MEF2A

Gene Name

myocyte enhancer factor 2A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130926.2		Intron			NP_001124398.1
NM_001130927.2		Intron			NP_001124399.1
NM_001130928.2		Intron			NP_001124400.1
NM_001171894.2		Intron			NP_001165365.1
NM_001319206.1		Intron			NP_001306135.1
NM_005587.3		Intron			NP_005578.2
XM_005254914.2		Intron			XP_005254971.1
XM_005254915.2		Intron			XP_005254972.1
XM_005254916.3		Intron			XP_005254973.1
XM_011521571.2		Intron			XP_011519873.1
XM_011521572.2		Intron			XP_011519874.1
XM_011521573.2		Intron			XP_011519875.1
XM_011521576.2		Intron			XP_011519878.1
XM_011521577.2		Intron			XP_011519879.1
XM_011521578.2		Intron			XP_011519880.1
XM_011521579.2		Intron			XP_011519881.1
XM_011521581.2		Intron			XP_011519883.1
XM_011521582.2		Intron			XP_011519884.1
XM_011521583.2		Intron			XP_011519885.1
XM_011521585.2		Intron			XP_011519887.1
XM_011521586.2		Intron			XP_011519888.1
XM_011521587.2		Intron			XP_011519889.1
XM_011521590.2		Intron			XP_011519892.1
XM_017022190.1		Intron			XP_016877679.1
XM_017022191.1		Intron			XP_016877680.1
XM_017022192.1		Intron			XP_016877681.1
XM_017022193.1		Intron			XP_016877682.1
XM_017022194.1		Intron			XP_016877683.1
XM_017022195.1		Intron			XP_016877684.1
XM_017022196.1		Intron			XP_016877685.1
XM_017022197.1		Intron			XP_016877686.1
XM_017022198.1		Intron			XP_016877687.1
XM_017022199.1		Intron			XP_016877688.1
XM_017022200.1		Intron			XP_016877689.1
XM_017022201.1		Intron			XP_016877690.1
XM_017022202.1		Intron			XP_016877691.1
XM_017022203.1		Intron			XP_016877692.1
XM_017022204.1		Intron			XP_016877693.1

View Full Product Details