Product Details

SNP ID: rs4283241
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:29977028 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGAGATAATGCACGTAAGGTACTCA[A/G]TAAATGTTATTTGTACCCTGCAAAT
Phenotype: MIM: 613199
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC107987231 PubMed Links

Gene Details

Gene: LOC107987231
Gene Name: uncharacterized LOC107987231

There are no transcripts associated with this gene.

Gene: TAOK2
Gene Name: TAO kinase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001252043.1		Intron			NP_001238972.1
NM_004783.3		Intron			NP_004774.1
NM_016151.3		Intron			NP_057235.2
XM_011545982.1		Intron			XP_011544284.1
XM_011545983.2		Intron			XP_011544285.1
XM_011545984.1		Intron			XP_011544286.1
XM_011545985.1		Intron			XP_011544287.1
XM_011545986.2		Intron			XP_011544288.1

Gene: TMEM219
Gene Name: transmembrane protein 219

There are no transcripts associated with this gene.

View Full Product Details