Product Details

SNP ID: rs473279
Assay Type: Functionally tested
NCBI dbSNP Submissions: 73
Location: Chr.1:37810130 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAAGGATGTAGACTGTTGAGTCAAA[C/T]AGCCCTTGGGAGGCCTGAGAACACA
Phenotype: MIM: 600172 MIM: 612276
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C1orf122 PubMed Links

Gene Details

Gene: C1orf122
Gene Name: chromosome 1 open reading frame 122

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142726.1	7573	Intron			NP_001136198.1
NM_198446.2	7573	Intron			NP_940848.2

Gene: MANEAL
Gene Name: mannosidase endo-alpha like

There are no transcripts associated with this gene.

Gene: MTF1
Gene Name: metal regulatory transcription factor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005955.2	7573	UTR 3			NP_005946.2
XM_011541491.2	7573	UTR 3			XP_011539793.1
XM_011541493.2	7573	Intron			XP_011539795.1
XM_011541494.1	7573	UTR 3			XP_011539796.1

Gene: YRDC
Gene Name: yrdC N6-threonylcarbamoyltransferase domain containing

There are no transcripts associated with this gene.

View Full Product Details