Product Details

SNP ID: rs173174
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:6740015 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGGGGAAACTGAGGCACAGGGTTG[A/C]GAATGAGGCGGGCAGAAGGAATCCT
Phenotype: MIM: 604504
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: GPR108 PubMed Links

Gene Details

Gene: GPR108
Gene Name: G protein-coupled receptor 108

There are no transcripts associated with this gene.

Gene: MIR6791
Gene Name: microRNA 6791

There are no transcripts associated with this gene.

Gene: TRIP10
Gene Name: thyroid hormone receptor interactor 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001288962.1		Intron			NP_001275891.1
NM_001288963.1		Intron			NP_001275892.1
NM_004240.3		Intron			NP_004231.1
XM_005259683.2		Intron			XP_005259740.1
XM_006722940.1		Intron			XP_006723003.1

View Full Product Details