Product Details

SNP ID
rs182533
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.10:112953271 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TTATTCCCCCCCTGCCCGGCGCCCA[A/G]ACATGCTTGGGAAGCTGGGAGAGCG
Phenotype
MIM: 602228 MIM: 614316
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
TCF7L2 PubMed Links

Gene Details

Gene
TCF7L2
Gene Name
transcription factor 7 like 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001146274.1 Intron NP_001139746.1
NM_001146283.1 Intron NP_001139755.1
NM_001146284.1 Intron NP_001139756.1
NM_001146285.1 Intron NP_001139757.1
NM_001146286.1 Intron NP_001139758.1
NM_001198525.1 Intron NP_001185454.1
NM_001198526.1 Intron NP_001185455.1
NM_001198527.1 Intron NP_001185456.1
NM_001198528.1 Intron NP_001185457.1
NM_001198529.1 Intron NP_001185458.1
NM_001198530.1 Intron NP_001185459.1
NM_001198531.1 Intron NP_001185460.1
NM_030756.4 Intron NP_110383.2
XM_005270071.1 Intron XP_005270128.1
XM_005270075.1 Intron XP_005270132.1
XM_005270077.1 Intron XP_005270134.1
XM_005270078.1 Intron XP_005270135.1
XM_005270079.1 Intron XP_005270136.1
XM_005270080.1 Intron XP_005270137.1
XM_005270084.1 Intron XP_005270141.1
XM_005270085.1 Intron XP_005270142.1
XM_005270086.1 Intron XP_005270143.1
XM_005270088.1 Intron XP_005270145.1
XM_005270089.1 Intron XP_005270146.1
XM_005270091.2 Intron XP_005270148.1
XM_005270092.1 Intron XP_005270149.1
XM_005270093.2 Intron XP_005270150.1
XM_005270094.2 Intron XP_005270151.1
XM_005270095.1 Intron XP_005270152.1
XM_005270096.2 Intron XP_005270153.1
XM_005270100.1 Intron XP_005270157.1
XM_005270101.2 Intron XP_005270158.1
XM_005270102.1 Intron XP_005270159.1
XM_005270103.1 Intron XP_005270160.1
XM_005270104.1 Intron XP_005270161.1
XM_011540109.1 Intron XP_011538411.1
XM_011540110.1 Intron XP_011538412.1
XM_011540111.1 Intron XP_011538413.1
XM_011540113.2 Intron XP_011538415.1
XM_011540116.1 Intron XP_011538418.1
XM_017016584.1 Intron XP_016872073.1
XM_017016585.1 Intron XP_016872074.1
XM_017016586.1 Intron XP_016872075.1
XM_017016587.1 Intron XP_016872076.1
XM_017016588.1 Intron XP_016872077.1
XM_017016589.1 Intron XP_016872078.1
XM_017016590.1 Intron XP_016872079.1
XM_017016591.1 Intron XP_016872080.1
XM_017016592.1 Intron XP_016872081.1
XM_017016593.1 Intron XP_016872082.1
XM_017016594.1 Intron XP_016872083.1
XM_017016595.1 Intron XP_016872084.1
XM_017016596.1 Intron XP_016872085.1
Gene
VTI1A
Gene Name
vesicle transport through interaction with t-SNAREs 1A
There are no transcripts associated with this gene.

View Full Product Details