Product Details

SNP ID: rs6978680
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:139427302 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTGGCATGTTCTCCAGGTAGCAGCA[A/G]AAACATTAGGGTGTTAGAGGTTTGG
Phenotype: MIM: 613056
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C7orf55-LUC7L2 PubMed Links

Gene Details

Gene: C7orf55-LUC7L2
Gene Name: C7orf55-LUC7L2 readthrough

There are no transcripts associated with this gene.

Gene: KLRG2
Gene Name: killer cell lectin like receptor G2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198508.2	1340	Intron			NP_940910.1
XM_005250311.3	1340	Intron			XP_005250368.1
XM_011516140.2	1340	Intron			XP_011514442.1
XM_011516141.2	1340	UTR 3			XP_011514443.1

Gene: LOC100129148
Gene Name: uncharacterized LOC100129148

There are no transcripts associated with this gene.

Gene: LUC7L2
Gene Name: LUC7 like 2, pre-mRNA splicing factor

There are no transcripts associated with this gene.

View Full Product Details