Product Details

SNP ID: rs76597357
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.3:187122398 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTCATGACAAAGGCATTTTTTTTT[A/T]ACTCTAAGATAATGGGGATAGTGGT
Phenotype: MIM: 607547
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: RPL39L PubMed Links
Additional Information: For this assay, SNP(s) [rs3835037] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_052969.1		Intron			NP_443201.1