Product Details

SNP ID: rs79686877
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.7:6378205 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTATTTCAATCTTCTGGGATGAGTT[G/T]TTTCCTTCTGGGACCCTGACTGATA
Phenotype: MIM: 602048
Polymorphism: G/T, Transversion Substitution
Allele Nomenclature
Literature Links: RAC1 PubMed Links
Additional Information: For this assay, SNP(s) [rs148740961] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: RAC1
Gene Name: ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006908.4		Intron			NP_008839.2
NM_018890.3		Intron			NP_061485.1