Product Details

SNP ID: rs77335949
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:75635268 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGGAGGCGCACAGTAGGGAAGAGT[A/C]AGGCCAGGTCGGGGTCGGGGCACAG
Phenotype: MIM: 603781
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: MYO15B PubMed Links

Gene Details

Gene: MYO15B
Gene Name: myosin XVB

There are no transcripts associated with this gene.

Gene: RECQL5
Gene Name: RecQ like helicase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001003715.3	1246	Intron			NP_001003715.1
NM_001003716.3	1246	Intron			NP_001003716.1
NM_004259.6	1246	Intron			NP_004250.4
XM_005257818.3	1246	Intron			XP_005257875.1
XM_005257822.3	1246	Intron			XP_005257879.1
XM_005257823.3	1246	Intron			XP_005257880.1
XM_006722186.2	1246	Intron			XP_006722249.1
XM_011525482.2	1246	Intron			XP_011523784.1
XM_011525484.1	1246	Intron			XP_011523786.1
XM_011525485.2	1246	Intron			XP_011523787.1
XM_011525486.2	1246	Intron			XP_011523788.1
XM_017025343.1	1246	Intron			XP_016880832.1
XM_017025344.1	1246	Intron			XP_016880833.1

Gene: SMIM5
Gene Name: small integral membrane protein 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001162995.2	1246	Intron			NP_001156467.1
XM_011525116.2	1246	UTR 3			XP_011523418.1
XM_011525118.2	1246	Intron			XP_011523420.1
XM_011525119.2	1246	Intron			XP_011523421.1
XM_017024943.1	1246	Intron			XP_016880432.1
XM_017024944.1	1246	Intron			XP_016880433.1
XM_017024945.1	1246	Intron			XP_016880434.1
XM_017024946.1	1246	Intron			XP_016880435.1
XM_017024947.1	1246	Intron			XP_016880436.1
XM_017024948.1	1246	Intron			XP_016880437.1

Gene: SMIM6
Gene Name: small integral membrane protein 6

There are no transcripts associated with this gene.

View Full Product Details