Product Details

SNP ID: rs78352335
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:57745724 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTGGGGCCCCTCTTCCTTCCCCAA[A/G]GACTTCAATCTTATTGCCCCAAGAG
Phenotype: MIM: 607914 MIM: 616715
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BTBD18 PubMed Links

Gene Details

Gene: BTBD18
Gene Name: BTB domain containing 18

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145101.1	2097	Silent Mutation	TCC,TCT	S183S	NP_001138573.1
XM_011545212.2	2097	Silent Mutation	TCC,TCT	S183S	XP_011543514.1
XM_017018127.1	2097	Silent Mutation	TCC,TCT	S183S	XP_016873616.1
XM_017018128.1	2097	Silent Mutation	TCC,TCT	S183S	XP_016873617.1

Gene: C11orf31
Gene Name: chromosome 11 open reading frame 31

There are no transcripts associated with this gene.

Gene: TMX2
Gene Name: thioredoxin related transmembrane protein 2

There are no transcripts associated with this gene.

Gene: TMX2-CTNND1
Gene Name: TMX2-CTNND1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details