Product Details
- SNP ID
-
rs111802286
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.9:35674980 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCATTTGGGACTCAGGACTGAAGTG[A/C]CCACTCACTTTTTTTTTTTTTTTTT
- Phenotype
-
MIM: 603179
MIM: 190990
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ARHGEF39
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs551485462] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ARHGEF39
- Gene Name
- Rho guanine nucleotide exchange factor 39
There are no transcripts associated with this gene.
- Gene
- CA9
- Gene Name
- carbonic anhydrase 9
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_001216.2 |
|
Intron |
|
|
NP_001207.2 |
- Gene
- TPM2
- Gene Name
- tropomyosin 2 (beta)
There are no transcripts associated with this gene.
View Full Product Details