Product Details

SNP ID: rs112473664
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7484795 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGGGGTGGCCCCCCCTCGGGGGAC[A/G]GCGCATGCCCGCTGCGCACCATCAA
Phenotype: MIM: 180660 MIM: 612308
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: POLR2A PubMed Links

Gene Details

Gene: POLR2A
Gene Name: RNA polymerase II subunit A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000937.4	417	Missense Mutation	AGC,GGC	S11G	NP_000928.1

Gene: SLC35G6
Gene Name: solute carrier family 35 member G6

There are no transcripts associated with this gene.

Gene: ZBTB4
Gene Name: zinc finger and BTB domain containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001128833.1	417	Intron			NP_001122305.1
NM_020899.3	417	Intron			NP_065950.2
XM_006721563.3	417	Intron			XP_006721626.1
XM_006721564.2	417	Intron			XP_006721627.1
XM_011523972.2	417	Intron			XP_011522274.1

View Full Product Details