Product Details

SNP ID: rs114144035
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:38409201 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCTGCTGCTCGACCCTCAAAGTT[C/G]TTTGCCCTATAGCACATCTATCCTG
Phenotype: MIM: 607320 MIM: 609293
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FAM98C PubMed Links

Gene Details

Gene: FAM98C
Gene Name: family with sequence similarity 98 member C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_174905.3	2973	Intron			NP_777565.3
XM_017026354.1	2973	Intron			XP_016881843.1

Gene: RASGRP4
Gene Name: RAS guanyl releasing protein 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001146202.1	2973	UTR 3			NP_001139674.1
NM_001146203.1	2973	UTR 3			NP_001139675.1
NM_001146204.1	2973	UTR 3			NP_001139676.1
NM_001146205.1	2973	UTR 3			NP_001139677.1
NM_001146206.1	2973	UTR 3			NP_001139678.1
NM_001146207.1	2973	UTR 3			NP_001139679.1
NM_170604.2	2973	UTR 3			NP_733749.1

Gene: SPRED3
Gene Name: sprouty related EVH1 domain containing 3

There are no transcripts associated with this gene.

View Full Product Details