Product Details

SNP ID: rs114933392
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:74461772 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTTGGGGCCGACCCACCACCCGAA[C/T]GAGCCCCTGAGGGGGCCTGGGCTTC
Phenotype: MIM: 616456 MIM: 601336 MIM: 606961
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: INO80B PubMed Links

Gene Details

Gene: INO80B
Gene Name: INO80 complex subunit B

There are no transcripts associated with this gene.

Gene: INO80B-WBP1
Gene Name: INO80B-WBP1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: MOGS
Gene Name: mannosyl-oligosaccharide glucosidase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001146158.1	1943	Missense Mutation	CTT,TTT	L567F	NP_001139630.1
NM_006302.2	1943	Missense Mutation	CTT,TTT	L673F	NP_006293.2
XM_017004876.1	1943	Missense Mutation			XP_016860365.1
XM_017004877.1	1943	Missense Mutation			XP_016860366.1

Gene: WBP1
Gene Name: WW domain binding protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012477.3	1943	Intron			NP_036609.1

View Full Product Details