Product Details

SNP ID: rs117993238
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:102152461 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGTTCCCAGCGACCTGTATCCCCT[A/C]GTGCTCGGCTTCCTGCGCGATAACC
Phenotype: MIM: 602394
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: NOLC1 PubMed Links

Gene Details

Gene: NOLC1
Gene Name: nucleolar and coiled-body phosphoprotein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284388.1	286	Silent Mutation	CTA,CTC	L17L	NP_001271317.1
NM_001284389.1	286	Silent Mutation	CTA,CTC	L17L	NP_001271318.1
NM_004741.4	286	Silent Mutation	CTA,CTC	L17L	NP_004732.2
XM_005270273.1	286	Silent Mutation	CTA,CTC	L17L	XP_005270330.1

Gene: PPRC1
Gene Name: peroxisome proliferator-activated receptor gamma, coactivator-related 1

There are no transcripts associated with this gene.

View Full Product Details