Product Details

SNP ID: rs151023546
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.11:118956953 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGAGAGCCTGCTGGTTGCCTTGCC[C/T]CCCTGTCACCTCACAGGAGGCAATG
Phenotype: MIM: 611558
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: UPK2 PubMed Links
Additional Information: For this assay, SNP(s) [rs3886020] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006760.3	200	Silent Mutation	CCC,CCT	P49P	NP_006751.1